Forging a BSgenome package
Introduction
In this tutorial we will use the BSgenome package to create an R package that contains the genome for Vibrio cholerae, but you can replace it with your favourite organism.
The BSgenome package provides a framework for interacting with genome information in R.
Alert: There may already be a BSgenome package for your favourite organism. Check the list of available genomes first.
Once you have forged (created) and installed the package, you will be able to load the genome as you would any other R package, like this:
library(BSgenome.Vcholerae.NCBI.N16961)
If V. cholerae happens to be your favourite organism too, and want to save yourself some time, you can download the package I created, and skip to the ‘Install your genome package’ section to get started.
Install the BSgenome package
if (!requireNamespace("BiocManager", quietly = TRUE))
install.packages("BiocManager")
BiocManager::install("BSgenome", version = "3.8")
Download the genome sequence
You will need to download the fasta files for the genome you want to forge. Since V. cholerae has two chromosomes, these are downloaded separately. You can use whatever source you like (EMBO, NCBI etc..) but make sure you get it in fasta file type.
For the V.cholerae reference genome (N16961):
At the NCBI website, click send to file, then select FASTA.
Prepare your files
I created a new folder on my Desktop and set this as my working directory:
setwd("~/Desktop/genomepackage")
Within this create another named seqs_srcdir
, move the fasta files here.
Make sure the files are appropriately named (i.e.. as-is from source) for V. cholerae the two chromosome fasta files are named: NC_002505.1.fa
and NC_002506.1.fa
. It is tempting to name them something more readable like “chromosome 1” but this can cause problems later.
Ensure the file extensions are .fa
if they are not already, on Mac double check by right-clicking and choosing ‘Get Info’ because it could still be .fasta
- if so, amend it.
Seed file
The seed file contains all the relevant metadata for the BSgenome package, so it is worth supplying as much information as you can. The easiest way to make a seed file is to edit one that already exists, so you can download my seed file and use it as a template.
You will need to use a text editor such as TextEdit on Mac (right-click and select open with > TextEdit) or RStudio. Use NCBI to populate the relevant information:
Package: BSgenome.Vcholerae.NCBI.N16961
Title: Full genome sequence for Vibrio cholerae O1 biovar El Tor str N16961
Description: Full genome sequence for the two chromosomes of Vibrio cholerae El Tor N16961 provided by NCBI
Version: 1.0.0
organism: Vibrio cholerae
common_name: V. cholerae
provider: NCBI
provider_version: ASM674v1
release_date: 2014/02
release_name: N16961
source_url: https://www.ncbi.nlm.nih.gov/genome/?term=Vibrio%20cholerae
organism_biocview: Vibrio_cholerae
BSgenomeObjname: Vcholerae
seqnames: c(“NC_002505.1”,“NC_002506.1”)
seqs_srcdir: /User/Desktop/genomepackage/seqs_srcdir
For genomes with multiple chromosomes, list them as a vector (see above example). Otherwise seqnames: chromosomenameFileName
is sufficient (you can remove the c()).
The BSgenomeObjname
is important because this is the name you will use to access the package in R once it has been installed.
Save it as is, and then edit the file name. Be careful with the file extensions, double check using ‘Get Info’ to ensure it has not been changed to .txt
or anything else.
Forge the package
The package is forged using the forgeBSgenomeDataPkg
function.
Simply use the name of the seed file as the only argument and it will create your package files to the same directory.
Alert:
Double check the sequence files are .fa
file types and that the details in the seed are correct before running.
forgeBSgenomeDataPkg("BSgenome.Vcholerae.NCBI.N16961-seed")
If you need to run the function again, delete the previous package files first.
Install your genome package
To install the genome package you will need to use the Mac command line (Terminal).
- Close R
- Open Terminal
- In Terminal navigate to your working directory:
- use
ls
to see list of files in the current directory - use
cd
to move to a directory (i.e..cd Desktop
)
- use
- Run
R CMD build BSgenome.Vcholerae.EBI.N16961
to compile the package - Run
R CMD check BSgenome.Vcholerae.EBI.N16961.tar.gz
to check it - Run
R CMD INSTALL BSgenome.Vcholerae.NCBI.N16961_1.0.0.tar.gz
Alert:
If you have downloaded my V. cholerae N16961 package you will need to navigate to wherever you have saved the file. Then run:
R CMD INSTALL BSgenome.Vcholerae.NCBI.N16961_1.0.0.tar.gz
And you’re done! It should now be ready to use.
Loading and accessing the genome in R
To use the genome in R you will need to load the package using the library()
function.
library(BSgenome.Vcholerae.NCBI.N16961)
Enter the BSgenomeObjname
(in this case Vcholerae) to print some general information about the genome to the console.
Vcholerae
## V. cholerae genome:
## # organism: Vibrio cholerae (V. cholerae)
## # genome: ASM674v1
## # provider: NCBI
## # release date: 2014/02
## # 2 sequences:
## # NC_002505.1 NC_002506.1
## # (use 'seqnames()' to see all the sequence names, use the '$' or '[[' operator
## # to access a given sequence)
length()
tells you how many chromosomes there are
length(Vcholerae)
## [1] 2
Vcholerae$NC_002505.1
tells you the length of chromosome I and a bit of its sequence
Vcholerae$NC_002505.1
## 2961149-letter DNAString object
## seq: AGGGTCATTAAATATATATAAAGATCTATATAGAGA...GGCTAGAAAATCGCTTTCCTGTTTTTTCGATCAAGG
alphabetFrequency(Vcholerae$NC_002505.1)
shows you the ACGT content of chromosome I
alphabetFrequency(Vcholerae$NC_002505.1)
## A C G T M R W S Y K V
## 769234 703384 708931 779567 0 0 0 0 0 0 0
## H D B N - + .
## 0 0 0 33 0 0 0
You can extract sequence from specific co-ordinates, for example to select the sequence from position 45 to 65 on chromosome I:
Vcholerae$NC_002505.1[45:65]
## 21-letter DNAString object
## seq: TTAGATCTACTATTAAGGAGC
You could then store this in a data frame, export the data frame as fasta file (with multiple sequence etc..) and use it somewhere else…